| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.077689 |
| Chromosome: | chromosome 12 |
| Location: | 5684386 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g532000 | (1 of 3) PF04359 - Protein of unknown function (DUF493) (DUF493) | 3'UTR | |
| Cre12.g532050 | (1 of 1) PF00069//PF04564//PF07714//PF12796 - Protein kinase domain (Pkinase) // U-box domain (U-box) // Protein tyrosine kinase (Pkinase_Tyr) // Ankyrin repeats (3 copies) (Ank_2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCCGGTGTAAAAAGCCTACAGCCTCAAATGGCAAGCCCGTGTCTTGT |
| Internal bar code: | ACGATTGCCGGCTAGACAGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3439 |
| LEAP-Seq percent confirming: | 77.0115 |
| LEAP-Seq n confirming: | 67 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 87 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTGTGTCAAACGTGCAAT |
| Suggested primer 2: | CGAAGCGCCATCAAGGAATG |