| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.077753 |
| Chromosome: | chromosome 14 |
| Location: | 3107940 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g628350 | CLPQ,HSLV1 | ATP-dependent subunit of mitochondrial HslUV protease; (1 of 1) K01419 - ATP-dependent HslUV protease, peptidase subunit HslV [EC:3.4.25.2] (hslV, clpQ) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCATGGGCTTGGGCATCGGCATGAAAGCGAGTGTGCCACACACGCAA |
| Internal bar code: | GACACGTTGTTAAGGGGTGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 596 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCACATGACATACGCACG |
| Suggested primer 2: | TTGGCCACCCACAAACTCTT |