Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.077757 |
Chromosome: | chromosome 3 |
Location: | 8849227 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g206033 | (1 of 1) PTHR23130//PTHR23130:SF94 - FAMILY NOT NAMED // PROTEIN F23B12.4, ISOFORM A | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCTACTACAAAGGAGGTTGCTGGAGGCGCACTCGCCTGCAATACTGCC |
Internal bar code: | TTATAGCGACAATAGCCTCGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 789 |
LEAP-Seq percent confirming: | 20.0 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCTAGTTTGAGCGCATGGA |
Suggested primer 2: | TGCATGCATGACAAACGCAA |