| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.077815 |
| Chromosome: | plastome |
| Location: | 189787 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802332 | ChreCp067,2717046,psaC | photosystem I iron-sulfur center; (1 of 1) K02691//K05575 - photosystem I subunit VII (psaC) // NAD(P)H-quinone oxidoreductase subunit 4 (ndhD) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAGCCATATTTAAATTTTAAGTTAATTTTTAAAGATGCTATATTTTTG |
| Internal bar code: | CGTTTAGGCGCGTCAAAGTATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 153 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATGCAAACATCCCGCATGG |
| Suggested primer 2: | GCCTTTGGCTGGAAGAGTCT |