| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.077895 |
| Chromosome: | chromosome 16 |
| Location: | 6747621 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g672650 | MITC14,MCP14 | Mitochondrial substrate carrier protein; (1 of 1) K15104 - solute carrier family 25 (mitochondrial oxoglutarate transporter), member 11 (SLC25A11, OGC) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCATCCACGCTCAACATCTTCGCATCATTAGACCATTCAGCAAATACG |
| Internal bar code: | TTAATTACGCTAAGCGATAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3669 |
| LEAP-Seq percent confirming: | 40.625 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 57 |
| LEAP-Seq n unique pos: | 96 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCACGCTCGTGTTCATGGA |
| Suggested primer 2: | CAATTCGGCGTGAATCCGTC |