| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.077905 |
| Chromosome: | chromosome 17 |
| Location: | 3226543 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g721600 | (1 of 1) K12847 - U4/U6.U5 tri-snRNP-associated protein 2 (USP39, SAD1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACACCCGCCCCCCGCCTGATGCCCTAAGCCCGCTCGTTGCTGTTTACAC |
| Internal bar code: | GTTTCCTACAATCGTGCACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1112 |
| LEAP-Seq percent confirming: | 96.2963 |
| LEAP-Seq n confirming: | 52 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGGGGAGAGGGTTGAAGC |
| Suggested primer 2: | GTTTGGGAACGTGACAAGGC |