Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.077918 |
Chromosome: | chromosome 17 |
Location: | 492398 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g699100 | TAGL1,TGL20,SDP1,LIP4 | Triacylglycerol lipase; (1 of 1) K14674 - TAG lipase / steryl ester hydrolase / phospholipase A2 / LPA acyltransferase (TGL4) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCGAGTCGCCCCAGGAGGCTACGGCGGGCAGGCCCACCGCCGACATG |
Internal bar code: | CCGGAGGAGGAGTAAGGGGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 661 |
LEAP-Seq percent confirming: | 68.1818 |
LEAP-Seq n confirming: | 30 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGAAGATCAGCGCCATCGA |
Suggested primer 2: | CCCACATATCCCGACAGCG |