Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.077930 |
Chromosome: | chromosome 8 |
Location: | 3036852 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g375200 | (1 of 1) K07870 - Ras homolog gene family, member T1 (RHOT1, ARHT1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTGCTGCAAGGCCGACCGCCTCAGCGACCGCGACAGCCCCAGCATCCG |
Internal bar code: | CGTGTTAAGGTCCGCATCTATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 335 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTTGGACGAGCAGTTGAGG |
Suggested primer 2: | GTGCTCGCTGCTTCTTATGC |