Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.077940 |
Chromosome: | chromosome 17 |
Location: | 5596197 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g739752 | FTSHi1,CTAP1,FTSHI1 | (1 of 3) IPR000642//IPR003593//IPR003959//IPR027417 - Peptidase M41 // AAA+ ATPase domain // ATPase, AAA-type, core // P-loop containing nucleoside triphosphate hydrolase; Chloroplast-import FtsH-like ATPase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACACACACACACACACACACACACACACACACACACAGATTGGCATCG |
Internal bar code: | GGATTTCGATGTTCCGCCGCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 612 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAAAGGCACTACTCCACCC |
Suggested primer 2: | CATATACGCGGGAGTGGACC |