| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.077961 |
| Chromosome: | chromosome 14 |
| Location: | 3669291 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g631200 | IC97,FAP94,DII6 | (1 of 1) K17580 - cancer susceptibility candidate protein 1 (CASC1); Flagellar Inner Arm Dynein I1/f intermediate chain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACATACACACACATACACGTATACACACATACACACCTGATTCCGTC |
| Internal bar code: | GCTGGATTCAACACAAATAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 365 |
| LEAP-Seq percent confirming: | 7.69231 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTGCCATACAGGGGGTTG |
| Suggested primer 2: | CTTCTCCCACCCGTTTCTCC |