| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.077979 |
| Chromosome: | chromosome 15 |
| Location: | 1849018 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g141706 | ERA1 | Putative chloroplast 16S rRNA processing factor; (1 of 1) K03595 - GTP-binding protein Era (era) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGACGTTAGCCACGGATGACAAGAACACGACTAAAGAGCCGTGCGGTCC |
| Internal bar code: | CTCGACTATGGATGCCCAGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 272 |
| LEAP-Seq percent confirming: | 11.1111 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCCAAGTCAAACCGTTGC |
| Suggested primer 2: | TTGCAAGGGGTTGGGAACTT |