| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.078014 |
| Chromosome: | plastome |
| Location: | 184866 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802330 | orf2971,ftsH,ChreCp065,2716962 | ATP-dependent zinc metalloprotease; (1 of 752) IPR027417 - P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTCGAAGAGGAAAGTGGGTCCATTTCCTCTGCTGGAATGCCTCTCGGG |
| Internal bar code: | CGGAACTAATGTTATGGAACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 177 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTAACCAACGACGACGCTT |
| Suggested primer 2: | GTCGACCAGGACGTTTGGAT |