Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.078072 |
Chromosome: | chromosome 12 |
Location: | 8487977 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g801480 | (1 of 9) IPR000477//IPR000536//IPR001584//IPR012337//IPR021109 - Reverse transcriptase domain // Nuclear hormone receptor, ligand-binding domain // Integrase, catalytic core // Ribonuclease H-like domain // Aspartic peptidase domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGAGAGGAGGGAAGAGACAGAGACCGAGGAGGGAGGAGAGGAGATGGA |
Internal bar code: | CGTCTCACTGTACGTATAAGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 234 |
LEAP-Seq percent confirming: | 6.25 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAGTCGTCTAGGTCCAGCA |
Suggested primer 2: | TTAGCGACATATCACCCCGC |