| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.078076 |
| Chromosome: | chromosome 8 |
| Location: | 822290 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g361050 | CNX3 | (1 of 2) 4.1.99.18 - Cyclic pyranopterin phosphate synthase / Molybdenum cofactor biosynthesis protein 1; Molybdenum cofactor synthesis-step 1 protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACGCCGCAGTCGGCAGTTCCCGGTCTCTACACTCAAGTACACTCCCAC |
| Internal bar code: | CGGCCCGTGGGGCCGGTGGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 511 |
| LEAP-Seq percent confirming: | 19.5652 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGGATGACTGCACACGTT |
| Suggested primer 2: | CGCTTGGCTTCGATTGTAGC |