| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.078088 |
| Chromosome: | chromosome 6 |
| Location: | 8619885 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g309826 | (1 of 1) 1.1.1.100//2.3.1.41//2.3.1.86 - 3-oxoacyl-[acyl-carrier-protein] reductase // Beta-ketoacyl-[acyl-carrier-protein] synthase I / KAS I // Fatty-acyl-CoA synthase / Yeast fatty acid synthase | intron | |
| Cre06.g800756 | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATTATGGTCGCGGGGACGGTATGCGGCCCCAAAAAAACAAGTCATCGA |
| Internal bar code: | AGCAAGACGTTGTTGTGCGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 339 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCAGTTAAGCGGGTAGGG |
| Suggested primer 2: | ATGTCGCAGTGAGTTCAGCA |