Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.078102 |
Chromosome: | chromosome 14 |
Location: | 193355 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g608900 | (1 of 6) PTHR13339:SF0 - COP9 SIGNALOSOME COMPLEX SUBUNIT 8 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAAGGCAGCCACCCTGTTGACCCATCAGCCTGCTGCCGCCCCCATGCC |
Internal bar code: | CCCATGTCGTGTAGGAGTTATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 787 |
LEAP-Seq percent confirming: | 13.0435 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAATTCCGACTGTGGGGGTC |
Suggested primer 2: | GCCACGTATGCAGTCCGATA |