| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.078123 |
| Chromosome: | plastome |
| Location: | 78759 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802296 | 2717032,ycf8,psbT,ChreCp031 | photosystem II protein T; (1 of 1) K02718 - photosystem II PsbT protein (psbT) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATTTAAATTCTAATTAAATGCTATTATTTAATCATACGTGGAGGATCTC |
| Internal bar code: | GATTAAGCCATCGGCCTGGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 599 |
| LEAP-Seq percent confirming: | 88.8889 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTACGATCTTCCGTGACGT |
| Suggested primer 2: | CTGGTCGGGCAAGTAAACCT |