| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.078124 |
| Chromosome: | chromosome 6 |
| Location: | 2015365 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g265350 | HTA42,HTA12,HTA11 | Histone H2A; (1 of 30) K11251 - histone H2A (H2A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCTTGACACCCGTTACCCAAACCCTGAACACCCGAAGTGACACGTGAA |
| Internal bar code: | CCAGAGGGGATGTGGTCGTCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4970 |
| LEAP-Seq percent confirming: | 76.6234 |
| LEAP-Seq n confirming: | 59 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCCAACACAATGGCTGG |
| Suggested primer 2: | GGACAAGGACTGGCATGGAA |