| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.078135 |
| Chromosome: | plastome |
| Location: | 18820 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802270 | petB,ChreCp008,2717017 | cytochrome b6; (1 of 1) K02635 - cytochrome b6 (petB) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCGTATTACCACTTTTAACAGCTGTTTTCATGTTAATGCACTTCTTAA |
| Internal bar code: | GATGTTTGCAATTGTTGAACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 282 |
| LEAP-Seq percent confirming: | 80.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGTTCCATCACGAAGGCT |
| Suggested primer 2: | CCCCTTCGGGCAACTAAAGT |