Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.078208 |
Chromosome: | chromosome 6 |
Location: | 6738627 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g295550 | (1 of 1) IPR006045//IPR011051//IPR013096 - Cupin 1 // RmlC-like cupin domain // Cupin 2, conserved barrel | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCAGTAAATCAAACACCGCACTTACAAATTCACACCACTGGAACACTC |
Internal bar code: | TAGCGTCTCAATTGTGCCCAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1009 |
LEAP-Seq percent confirming: | 21.2121 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACACCGAGTCCAAGCTCT |
Suggested primer 2: | TCGCCTATTCGACCTGATGC |