Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.078210 |
Chromosome: | chromosome 12 |
Location: | 3578839 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g496200 | XPO2 | Exportin-t; (1 of 1) K14288 - exportin-T (XPOT) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTTCCGTCGACTACTGGTCTACTGGTCCCAACAACACGCCAACCACCC |
Internal bar code: | TAATCGGGTGGGGGTCCAGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 193 |
LEAP-Seq percent confirming: | 3.84615 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 25 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTCATGAGCTGTCCTGTGA |
Suggested primer 2: | CGAAGCTACCAGGTGTGTGT |