Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.078214 |
Chromosome: | chromosome 12 |
Location: | 7730386 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g554700 | SEC22 | Qb-SNARE protein, Sec20-family; (1 of 1) K08517 - vesicle transport protein SEC22 (SEC22) | 3'UTR |
Cre12.g554750 | (1 of 5) IPR000626//IPR019956//IPR029071 - Ubiquitin domain // Ubiquitin // Ubiquitin-related domain; Ubiquitin-like Protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACGAGGAGTCTGTCAAGGCGTCCAAACTTACGACATGGCCTTTCGGCC |
Internal bar code: | CGAAAAAGTCGCCTGGTTGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2540 |
LEAP-Seq percent confirming: | 90.9091 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTCCCAACAACACGTCAGC |
Suggested primer 2: | TAGTTGTGCCTGACGGTGTC |