| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.078239 |
| Chromosome: | chromosome 6 |
| Location: | 1211451 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g258400 | (1 of 1) PF08737 - Rgp1 (Rgp1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGTGGGTGTGTGGGCAGAGGCAGCGTGCAGTGAGGGCAACGGCCGTTT |
| Internal bar code: | TCAGATAGGTGGTTTGCCGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 139 |
| LEAP-Seq percent confirming: | 10.7143 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 100 |
| LEAP-Seq n unique pos: | 112 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCTCGAACTCAACCCCA |
| Suggested primer 2: | AACAGTCCTACCACTTGCCG |