Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.078284 |
Chromosome: | chromosome 7 |
Location: | 1457031 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g323750 | HAS2 | (1 of 1) K06133 - 4'-phosphopantetheinyl transferase (LYS5, acpT); Holo-[acyl-carrier-protein] synthase | 3'UTR |
lncRNA_TCONS_00052104 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCCATTGATGAGCATTGGCCACACTTGCTCTCTTTGCACAACATCTTA |
Internal bar code: | CTTTCAATTGGGGGTCGTGCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 122 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCAAGGCAACACTGGGGTTT |
Suggested primer 2: | CTTCCAGGTGAGCCATGGTT |