| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.078305 |
| Chromosome: | plastome |
| Location: | 62665 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802290 | ChreCp026,2716975,psbM | photosystem II protein M; (1 of 1) K02714 - photosystem II PsbM protein (psbM) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGTCGCAAGGGAGCAAAAGGCAAAGCAGTAACTTATTAGTCTGTTTCC |
| Internal bar code: | TCTCACCTCGAATATGGGTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 232 |
| LEAP-Seq percent confirming: | 52.1739 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTGATGCCTCGCCTATCG |
| Suggested primer 2: | TTGGTTGGACACAGGTTGCT |