| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.078340 |
| Chromosome: | chromosome 10 |
| Location: | 2723937 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g437850 | SAE1,CBP20 | CAP-binding protein 20; (1 of 1) K12883 - nuclear cap-binding protein subunit 2 (NCBP2, CBP20) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCATCGAACTGCGGTAACATGTCAAGTTCTAAGCTTACAACCTGGGAT |
| Internal bar code: | GTATACGATAAGACTACATGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4917 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 105 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 105 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCCCAATCAAGCGATCTT |
| Suggested primer 2: | CACAGCAAGGAGGAGGTGAG |