| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.078363 |
| Chromosome: | chromosome 1 |
| Location: | 1516188 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g008150 | RPK1 | RNA-polymerase-subunit kinase; (1 of 1) IPR000719//IPR001932//IPR002290//IPR011009 - Protein kinase domain // PPM-type phosphatase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACACGCACGCACACACACACACAGGTCGTTCACGAGGCGAACATCAC |
| Internal bar code: | ATGGCAGGTATGGACTGCCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1131 |
| LEAP-Seq percent confirming: | 27.7778 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTTCCGGACCCCAAGAG |
| Suggested primer 2: | CGTGAACTCGACCACCGTAA |