| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.078404 |
| Chromosome: | chromosome 3 |
| Location: | 3924515 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g171000 | (1 of 1) IPR003072//IPR006569//IPR008942 - Orphan nuclear receptor, NOR1 type // CID domain // ENTH/VHS | 5'UTR | |
| Cre03.g171050 | GHL1 | (1 of 2) 3.2.1.21 - Beta-glucosidase / Gentobiase; Glycosyl hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTATTCGCTGCGGGCTTGCCCGAGCCCGTCATTCCGACGCTAAGCTGC |
| Internal bar code: | GGCTGCTTGCAAGCGTTTCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 918 |
| LEAP-Seq percent confirming: | 8.33333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGGGTCAGCTGATCACCA |
| Suggested primer 2: | ACAGGCTAGGTGGCACTTTC |