| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.078429 |
| Chromosome: | chromosome 10 |
| Location: | 2841887 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g439100 | CCT1 | T-complex protein 1, alpha subunit; (1 of 1) K09493 - T-complex protein 1 subunit alpha (CCT1, TCP1) | 3'UTR |
| Cre10.g439150 | RPT5,GEX36 | (1 of 1) K03065 - 26S proteasome regulatory subunit T5 (PSMC3, RPT5); 26S proteasome regulatory subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAACCAAGGGCTCACCCGCAATGGAGGGCGATACCCCGAGCATGAGGA |
| Internal bar code: | GCGTAGGAGGTTGTTGGCAGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1421 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 43 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTGCAAAAATGCTCGGAA |
| Suggested primer 2: | GAGGAGATGGACTGATGGCG |