| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.078433 |
| Chromosome: | chromosome 2 |
| Location: | 3919382 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g101900 | EXN6 | (1 of 7) IPR002562//IPR012337 - 3'-5' exonuclease domain // Ribonuclease H-like domain; 3'-5' exonuclease | 3'UTR |
| Cre02.g101950 | TRM2B,TMU2 | tRNA (uracil-5)-methyltransferase; (1 of 1) K15332 - tRNA (uracil-5-)-methyltransferase [EC:2.1.1.-] (TRMT2A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACCAGCGATGCAGTCTTGCTGAAGCCACAAGGGCATACCCAGTAACCC |
| Internal bar code: | TGATATTTTGAAGGCGAGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 785 |
| LEAP-Seq percent confirming: | 21.2121 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGATGATGAGGAGCAGA |
| Suggested primer 2: | GTCGTGTACCTATGAGGGCG |