Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.078434 |
Chromosome: | chromosome 3 |
Location: | 3902706 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g170750 | RNP3 | Small nucleolar ribonucleoprotein U3 component; (1 of 1) K14560 - U3 small nucleolar ribonucleoprotein protein IMP3 (IMP3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCATGGGTATCATCCCCACCAAGAAGAGCCTGGTGCAGTGCGACAAGC |
Internal bar code: | GCTTGATGAGCAGGGATGTCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 167 |
LEAP-Seq percent confirming: | 9.09091 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTTCGTGGAAGTGGATGGT |
Suggested primer 2: | GCGTCAACTAAAGCACCACG |