| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.078457 |
| Chromosome: | chromosome 6 |
| Location: | 4729642 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g279300 | (1 of 1) 2.7.10.1//2.7.10.2//2.7.11.1 - Receptor protein-tyrosine kinase / Receptor protein tyrosine kinase // Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | 3'UTR | |
| Cre06.g279350 | (1 of 1) 3.5.1.17 - Acyl-lysine deacylase / Epsilon-lysine acylase | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCTGTAGACAGCAAGCTGCTTGATCACTCACGGCGCTTTCGCTGCGCC |
| Internal bar code: | GAGGTACAATCACGGAAAACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5463 |
| LEAP-Seq percent confirming: | 98.5916 |
| LEAP-Seq n confirming: | 70 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAAAGGAGCTGAACCGGG |
| Suggested primer 2: | CAGCAACCAAGCAACAGGAC |