| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.078471 |
| Chromosome: | plastome |
| Location: | 61763 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802289 | ChreCp025,rps14,2716974 | (1 of 1) K02954 - small subunit ribosomal protein S14 (RP-S14, MRPS14, rpsN); 30S ribosomal protein S14 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCTAAAAAAAGCATGATTCAGCGTGAATTAAAACGCCAAAAATTAGTA |
| Internal bar code: | CTACATAGACATTAATGACCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 132 |
| LEAP-Seq percent confirming: | 14.2857 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGTACCACTGCCACTAAT |
| Suggested primer 2: | AGCAACCTGTGTCCAACCAA |