| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.078480 |
| Chromosome: | plastome |
| Location: | 139122 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802321 | psbA,2716987,ChreCp057 | (1 of 2) K02703 - photosystem II P680 reaction center D1 protein (psbA); photosystem II protein D1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTATCTTCTTCGGGGTATATAAAGATCCCTAAGTTTACTTGCCTAGGC |
| Internal bar code: | ATTAGATAAACAATTCAAATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 391 |
| LEAP-Seq percent confirming: | 16.2791 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAAGAAGCCCCACCACCAA |
| Suggested primer 2: | CTGACTGCCGAACAAGTTGC |