| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.078531 |
| Chromosome: | chromosome 16 |
| Location: | 7462425 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g681578 | APC8 | (1 of 1) K03355 - anaphase-promoting complex subunit 8 (APC8, CDC23); Anaphase promoting complex subunit 8 | 5'UTR |
| Cre16.g681690 | (1 of 274) IPR020683 - Ankyrin repeat-containing domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGACACGCTAACCCGAACGGCCGGACCCCACTCATTCTACTTGCCTTTC |
| Internal bar code: | TAGTGTTCTTGTCCTTACTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 569 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCACCTGCTTGGGTTAGAG |
| Suggested primer 2: | AAGGTACTGGGGGTGGTTCT |