Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.078532 |
Chromosome: | chromosome 6 |
Location: | 7692606 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g302400 | TNP17,CSB31 | {"Probable transposon-derived protein of Chlamydomonas-Specific family B; (1 of 1) IPR000104//IPR010095 - Antifreeze protein, type I // Transposase IS605, OrfB, C-terminal | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGGATTTGCGGGGATGCCAAAGGCCCCCAACATAGAGGCGTGTGCTT |
Internal bar code: | TTGATAACGGACTTACCGCAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4233 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 65 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAGTTACAGTGCAGTCCGT |
Suggested primer 2: | GCTTTAGCGGAACCATGCAG |