| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.078547 |
| Chromosome: | chromosome 8 |
| Location: | 2078601 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g369200 | (1 of 2) IPR000104//IPR000719//IPR002290//IPR011009 - Antifreeze protein, type I // Protein kinase domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain | 5'UTR | |
| Cre08.g369250 | FAP400 | Flagellar Associated Protein 400 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAAGCTGTGAATATGTATAGACTAGACTTAGAGGTTGCGAAGATAAAA |
| Internal bar code: | GGCTATTCCGAGTCTGAGTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1430 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGCAACTGGCCAAAATCA |
| Suggested primer 2: | ACGAGCTGGCTGTTAGTCAC |