| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.078548 |
| Chromosome: | chromosome 13 |
| Location: | 77455 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g801505 | (1 of 2) PTHR10642//PTHR10642:SF7 - RIBONUCLEASE H1 // SUBFAMILY NOT NAMED | intron | |
| Cre13.g801506 | (1 of 2) PTHR10642 - RIBONUCLEASE H1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCATGTCAGCTTGTGATGCTGTGGATGCTGCGGGGGCCCACTGCTCG |
| Internal bar code: | TACGACTAACTCGGTTTTGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 206 |
| LEAP-Seq percent confirming: | 35.2941 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCTACAACAACTGGCCGG |
| Suggested primer 2: | ATGCAGAACACGTCCTCCAG |