| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.078624 |
| Chromosome: | chromosome 9 |
| Location: | 2506987 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g392950 | TMG12 | tRNA (guanosine-2'-O)-methyltransferase; (1 of 1) PTHR12029//PTHR12029:SF55 - RNA METHYLTRANSFERASE // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAACTAGAACAATCACACCCCAACCCACTGTGACTTCTGTCCTGGATTC |
| Internal bar code: | ACAAACTGTAAAAATATTCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 296 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTAATGAGCTACCGTCCCC |
| Suggested primer 2: | GTAGTATGTGCCTGGCAGCA |