Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.078642 |
Chromosome: | chromosome 12 |
Location: | 3621232 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g513245 | (1 of 1) PF15243 - Anaphase-promoting complex subunit 15 (ANAPC15) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCCGCCAAAACCCCACCGCTGCCCAAAACCCATACCCCCCAACGTGTG |
Internal bar code: | AGCTTAAGTATCCTTCGTCATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 845 |
LEAP-Seq percent confirming: | 27.2727 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCCTTTTGCAGGGGTCTAT |
Suggested primer 2: | GTCTTTTGTTCCACACCCGC |