| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.078650 |
| Chromosome: | mitogenome |
| Location: | 7639 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreMt.g802341 | 801491,nad2,ChrepMp05 | (1 of 1) K03879 - NADH-ubiquinone oxidoreductase chain 2 (ND2); NADH dehydrogenase subunit 2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAGCGTACAAGCCTTCAGTTTGTTGGCTGCTGCTTTGTTCTGCACTTT |
| Internal bar code: | TGACAAATCGTTATTTGTTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 432 |
| LEAP-Seq percent confirming: | 7.14286 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCTCAGTGGCTGGGATCT |
| Suggested primer 2: | CAACGGCCATGTGTCTTTGG |