Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.078654 |
Chromosome: | chromosome 12 |
Location: | 5117032 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g526010 | (1 of 10) IPR000511 - Cytochrome c/c1 haem-lyase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTACACGCGTGACTGAAACCCCCACCTTGCCCCTCCCCCATTCTTCAAC |
Internal bar code: | GGGTTGTCCTATTTTATGCTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1730 |
LEAP-Seq percent confirming: | 2.5 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 39 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCATGAGGGCAGACACGT |
Suggested primer 2: | GTCCGGTCGCTACCTACATG |