| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.078700 |
| Chromosome: | chromosome 13 |
| Location: | 5238695 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g607750 | CCDC65,DRC2,FAP250 | Nexin-dynein regulatory complex 2; (1 of 1) PTHR21625:SF0 - COILED-COIL DOMAIN-CONTAINING PROTEIN 65 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGTGGCGACACCCGTCGACACCCGTGTTAGGCTACTAGCCATATAGCA |
| Internal bar code: | TGTGTCATGTTAAGTGTGTAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4617 |
| LEAP-Seq percent confirming: | 86.4865 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCGACGGTACAACAAGGTG |
| Suggested primer 2: | GTCGGGAGGGTAGAGTGAGT |