Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.078701 |
Chromosome: | chromosome 16 |
Location: | 5870658 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g679500 | NUOB8 | (1 of 1) K03946 - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex subunit 2 (NDUFA2); NADH:ubiquinone oxidoreductase 11 kDa subunit | 3'UTR |
Cre16.g679550 | FAP277 | Flagellar Associated Protein 277; (1 of 1) K13963 - serpin B (SERPINB) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGATGAGTGGTCCGTAGTACTTAAGCAAATAGGTATAATAGCAACCCCA |
Internal bar code: | TACCGAATCGGAGTCATGCGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1708 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 41 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGATGCATCGATGGTACGG |
Suggested primer 2: | CGCATTCAAGCAGCTCTTCC |