| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.078722 |
| Chromosome: | chromosome 17 |
| Location: | 6022035 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g742700 | CGLD30,HLM32 | (1 of 1) PTHR22884:SF343 - PROTEIN MET-1, ISOFORM A; SET domain containing protein, putative histone methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCCGTGTTGTGCTGGCCATGATGTCGCCTTCAGTTCGCGGCAGCCAC |
| Internal bar code: | CGCAAGGTATCCTTCGTTTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 861 |
| LEAP-Seq percent confirming: | 14.2857 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCTATTCACGCAGCCGAG |
| Suggested primer 2: | CGTCCCCACACTCATTGACA |