| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.078737 |
| Chromosome: | chromosome 4 |
| Location: | 111867 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g216650 | (1 of 1) PF01947 - Protein of unknown function (DUF98) (DUF98) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTGTCTCGCTGCAAGGCTCAAGCATCGGTCCCTCGACAATCACCTCCG |
| Internal bar code: | GTTCGTGTGCTAGTATTGGATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2641 |
| LEAP-Seq percent confirming: | 48.0519 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTTCAGTGTTGCCCGTTC |
| Suggested primer 2: | CATGGACAGACACTCCTGCA |