| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.078761 |
| Chromosome: | chromosome 3 |
| Location: | 6043339 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g190000 | PPP14 | Phosphoprotein phosphatase 2C-related; (1 of 70) 3.1.3.16 - Protein-serine/threonine phosphatase / Serine/threonine specific protein phosphatase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTCACTACCAACAGCCTTACTTCCTTGTCACTGTCATCTGAAGCTAGC |
| Internal bar code: | AATCCATTGTAATCAGGCGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1090 |
| LEAP-Seq percent confirming: | 76.9231 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATCCAGAGAACCCCGCTGA |
| Suggested primer 2: | CAGCCGCTACAGGATCTGAG |