| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.078777 |
| Chromosome: | chromosome 7 |
| Location: | 5657201 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g352550 | RDP3 | Putative rhodanese domain phosphatase; (1 of 3) K18065 - Cdc25 family phosphatase [EC:3.1.3.48 1.20.4.-] (CDC25) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGCCTTACATGGCACCCATGGTCCCTTGCGGCGTGCAGGAGGTGGCC |
| Internal bar code: | AGTTAATGTGTAGCCAATCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2596 |
| LEAP-Seq percent confirming: | 48.1481 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCAATGGTCGCTCGAACCA |
| Suggested primer 2: | TTGATGCGGGGGATTGACTC |