| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.078801 |
| Chromosome: | chromosome 3 |
| Location: | 3164097 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g164950 | SRS3 | Serine/arginine-rich pre-mRNA splicing factor; (1 of 5) IPR000504//IPR012677 - RNA recognition motif domain // Nucleotide-binding alpha-beta plait domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGACTGCTGCTTGCGGGGATATAGAAGGAACACTCGCGGACATTCCAA |
| Internal bar code: | TCGAATGTTGTAGTTGGGCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 559 |
| LEAP-Seq percent confirming: | 52.0 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCTGAGTGGTCGTCAATG |
| Suggested primer 2: | CATAGTCCAGTGCTAGCCCG |