| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.078821 |
| Chromosome: | chromosome 7 |
| Location: | 1394382 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g323000 | DP1,TDP1 | Transcription factor, E2F/dimerisation partner; (1 of 2) PTHR12548:SF9 - TRANSCRIPTION FACTOR DP | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGAAAGCGCGGGAGGCCCACATTGGCCGCCCCGTGGAAGTGATGGCCAT |
| Internal bar code: | GGTTGTCCAGGAACGTGCCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1439 |
| LEAP-Seq percent confirming: | 64.9123 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGTGTCAGCAATGGGTCT |
| Suggested primer 2: | CTCGCGGTGCCTGTATATGT |